tuba1

Ensembl ID:
ENSDARG00000045367
ZFIN ID:
ZDB-GENE-030822-1
Description:
tubulin alpha-1C chain [Source:RefSeq peptide;Acc:NP_919369]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44030 Missense, Nonsense Mutation detected in F1 DNA During 2016
sa12077 Nonsense Available for shipment Available now
sa19333 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa44030
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066715 Nonsense 431 448 3 3
ENSDART00000113297 Missense 185 220 5 5
ENSDART00000123518 Nonsense 432 449 4 4
Genomic Location:
Chromosome 23 (position 35767882)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCGAGTTCTCTGAGGCCAGAGAGGACATGGCTGCCCTGGAGAAAGATTA[T/A]GAGGAGGTTGGAGCTGAGAGTGTGGAAGGAGAAGATGAGGGTGAGGAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12077
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066715   None 448 3 3
ENSDART00000113297 Nonsense 215 220 5 5
ENSDART00000123518   None 449 4 4
ENSDART00000066715   None 448 3 3
ENSDART00000113297 Nonsense 215 220 5 5
ENSDART00000123518   None 449 4 4
Genomic Location:
Chromosome 23 (position 35767973)
KASP Assay ID:
554-6200.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTGAGGAATATTAGAAATGCTGCCWGCTGTGTTTCCTGTCCATTGTCATA[T/G]TTTTGTGTTCTATTATAACTTTYCASTTGTCAACTGGCTAAAAGRTCAAW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066715   None 448 3 3
ENSDART00000113297 Nonsense 215 220 5 5
ENSDART00000123518   None 449 4 4
ENSDART00000066715   None 448 3 3
ENSDART00000113297 Nonsense 215 220 5 5
ENSDART00000123518   None 449 4 4
Genomic Location:
Chromosome 23 (position 35767973)
KASP Assay ID:
554-6200.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAGGAATATTAGAAATGCTGCCTGCTGTGTTTCCTGTCCATTGTCATA[T/G]TTTTGTGTTCTATTATAACTTTCCAGTTGTCAACTGGCTAAAAGGTCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link