tuba1

Ensembl ID:
ENSDARG00000045367
ZFIN ID:
ZDB-GENE-030822-1
Description:
tubulin alpha-1C chain [Source:RefSeq peptide;Acc:NP_919369]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12077 Nonsense Available for shipment Available now
sa19333 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12077
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066715 None None 448 3 3
ENSDART00000113297 Nonsense 215 220 5 5
ENSDART00000123518 None None 449 4 4
ENSDART00000066715 None None 448 3 3
ENSDART00000113297 Nonsense 215 220 5 5
ENSDART00000123518 None None 449 4 4
Genomic Location:
Chromosome 23 (position 35767973)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTGAGGAATATTAGAAATGCTGCCWGCTGTGTTTCCTGTCCATTGTCATA[T/G]TTTTGTGTTCTATTATAACTTTYCASTTGTCAACTGGCTAAAAGRTCAAW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066715 None None 448 3 3
ENSDART00000113297 Nonsense 215 220 5 5
ENSDART00000123518 None None 449 4 4
ENSDART00000066715 None None 448 3 3
ENSDART00000113297 Nonsense 215 220 5 5
ENSDART00000123518 None None 449 4 4
Genomic Location:
Chromosome 23 (position 35767973)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAGGAATATTAGAAATGCTGCCTGCTGTGTTTCCTGTCCATTGTCATA[T/G]TTTTGTGTTCTATTATAACTTTCCAGTTGTCAACTGGCTAAAAGGTCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qs8ts8um