trappc3

Ensembl ID:
ENSDARG00000045364
ZFIN ID:
ZDB-GENE-040801-120
Description:
trafficking protein particle complex subunit 3 [Source:RefSeq peptide;Acc:NP_001003601]
Human Orthologue:
TRAPPC3
Human Description:
trafficking protein particle complex 3 [Source:HGNC Symbol;Acc:19942]
Mouse Orthologue:
Trappc3
Mouse Description:
trafficking protein particle complex 3 Gene [Source:MGI Symbol;Acc:MGI:1351486]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14418 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14418
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066712 Essential Splice Site 47 180 2 5
Genomic Location:
Chromosome 19 (position 37277847)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAAGGACTATGAAAATGATGAAGAGGTCAACAAACAACTGGATAAAATG[T/G]RAGTCTGCCTTTCCCTTGCTTTCATTCTGATTTAGYCCTCTCATCAYYAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3o7oe7e1