usp46

Ensembl ID:
ENSDARG00000045343
ZFIN ID:
ZDB-GENE-070705-213
Description:
Ubiquitin carboxyl-terminal hydrolase 46 [Source:UniProtKB/Swiss-Prot;Acc:A5WWB0]
Human Orthologue:
USP46
Human Description:
ubiquitin specific peptidase 46 [Source:HGNC Symbol;Acc:20075]
Mouse Orthologue:
Usp46
Mouse Description:
ubiquitin specific peptidase 46 Gene [Source:MGI Symbol;Acc:MGI:1916977]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15815 Nonsense Available for shipment Available now
sa7932 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15815
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066678 Nonsense 149 375 5 11
ENSDART00000132093 Nonsense 145 370 4 9
Genomic Location:
Chromosome 20 (position 23091924)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTGAACACGGTGGCKGATATCCTGCAGGAGGAGAGAAAACAGGAGAAG[C/T]AGAACGGACGAYTGAARAACAACGGCACTGCCATCGCCACAGACACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7932
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066678 Essential Splice Site 221 375 6 11
ENSDART00000132093 Essential Splice Site 217 370 5 9
Genomic Location:
Chromosome 20 (position 23094456)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTGTCTGTAGATGTTGAGCAGAACACTTCAATAACACACTGTCTCAGG[T/C]AGACATATGCACAAACACAAAACGCATAACATTAATCACACATGCTGATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qe9pq7qv