usp46

Ensembl ID:: ENSDARG00000045343
ZFIN ID:: ZDB-GENE-070705-213
Description:: Ubiquitin carboxyl-terminal hydrolase 46 [Source:UniProtKB/Swiss-Prot;Acc:A5WWB0]
Human Orthologue:: USP46
Human Description:: ubiquitin specific peptidase 46 [Source:HGNC Symbol;Acc:20075]
Mouse Orthologue:: Usp46
Mouse Description:: ubiquitin specific peptidase 46 Gene [Source:MGI Symbol;Acc:MGI:1916977]

Alleles

There are 2 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa15815	Nonsense	Available for shipment	Available now
sa7932	Essential Splice Site	Mutation detected in F1 DNA	During 2015

Mutation Details

Allele Name:: sa15815
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000066678	Nonsense	149	375	5	11
ENSDART00000132093	Nonsense	145	370	4	9

Genomic Location:: Chromosome 20 (position 23091924)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: TGTTGAACACGGTGGCKGATATCCTGCAGGAGGAGAGAAAACAGGAGAAG[C/T]AGAACGGACGAYTGAARAACAACGGCACTGCCATCGCCACAGACACAGAG
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa7932
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: T > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000066678	Essential Splice Site	221	375	6	11
ENSDART00000132093	Essential Splice Site	217	370	5	9

Genomic Location:: Chromosome 20 (position 23094456)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: ACTTGTCTGTAGATGTTGAGCAGAACACTTCAATAACACACTGTCTCAGG[T/C]AGACATATGCACAAACACAAAACGCATAACATTAATCACACATGCTGATG
Associated Phenotype:: Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Biochemical measures: Genome-wide association study of biochemical traits in Korcula Island, Croatia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

OMIM information for USP46

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: