
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
usp46
- Ensembl ID:
- ENSDARG00000045343
- ZFIN ID:
- ZDB-GENE-070705-213
- Description:
- Ubiquitin carboxyl-terminal hydrolase 46 [Source:UniProtKB/Swiss-Prot;Acc:A5WWB0]
- Human Orthologue:
- USP46
- Human Description:
- ubiquitin specific peptidase 46 [Source:HGNC Symbol;Acc:20075]
- Mouse Orthologue:
- Usp46
- Mouse Description:
- ubiquitin specific peptidase 46 Gene [Source:MGI Symbol;Acc:MGI:1916977]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15815 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15815
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000066678 | Nonsense | 149 | 375 | 5 | 11 |
ENSDART00000132093 | Nonsense | 145 | 370 | 4 | 9 |
- Genomic Location (Zv9):
- Chromosome 20 (position 23091924)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 23205311 GRCz11 20 23104411 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTTGAACACGGTGGCKGATATCCTGCAGGAGGAGAGAAAACAGGAGAAG[C/T]AGAACGGACGAYTGAARAACAACGGCACTGCCATCGCCACAGACACAGAG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Biochemical measures: Genome-wide association study of biochemical traits in Korcula Island, Croatia. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: