pkp4

Ensembl ID:
ENSDARG00000045331
Human Orthologue:
PKP4
Human Description:
plakophilin 4 [Source:HGNC Symbol;Acc:9026]
Mouse Orthologue:
Pkp4
Mouse Description:
plakophilin 4 Gene [Source:MGI Symbol;Acc:MGI:109281]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11665 Nonsense Available for shipment Available now
sa1487 Nonsense Available for shipment Available now
sa40649 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11665
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110998 Nonsense 68 1134 2 21
Genomic Location (Zv9):
Chromosome 6 (position 12181837)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12035059
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYACCAGAGAACTCGARGAGGAGAGACAGATTGTAGCCAATCAGTTGGAG[C/T]GATGCAGGTTGGGGGCGGAGTCTCCAGGTGCTGCAAGTGACAGGTAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1487
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110998 Nonsense 407 1134 8 21
Genomic Location (Zv9):
Chromosome 6 (position 12144659)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 11997881
KASP Assay ID:
554-1412.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTCTCTCACTCAGGGTTTGGTACTTTACAAAGGACCACGAGTCAGTG[T/A]AGCACTCTRAGGTACCAGCGAGGGTTATTCTCTATGGGCTCCATGGCAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa40649
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110998 Essential Splice Site 855 1134 15 21
Genomic Location (Zv9):
Chromosome 6 (position 12124932)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 11978154
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCGTTACGAAACATGGCTCTGGACGCCAGGAACAAAGAGCTCATCGG[T/G]CAGTCACTCAAACCTATTGCTACCAACTTTCTTACATTCCCTTTTTTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link