map7d2b

Ensembl ID:
ENSDARG00000045316
ZFIN ID:
ZDB-GENE-091118-82
Human Orthologue:
MAP7D2
Human Description:
MAP7 domain containing 2 [Source:HGNC Symbol;Acc:25899]
Mouse Orthologue:
Mtap7d2
Mouse Description:
MAP7 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917474]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8568 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8568
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080602 Essential Splice Site 87 649 3 18
ENSDART00000140170 Essential Splice Site 19 552 3 16

The following transcripts of ENSDARG00000045316 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 24763515)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGCTCTGCYGTCGAGGAGAAGAGACRCCARCGCGTGGAAGACRAGAAG[G/A]TCAGAGCTYTTGGACTAACTTTGTATCATTCTGAAGCTTTTTTATGTATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0exipzz8