pola1

Ensembl ID:
ENSDARG00000045308
ZFIN ID:
ZDB-GENE-030114-9
Description:
DNA polymerase [Source:UniProtKB/TrEMBL;Acc:Q6DRM6]
Human Orthologue:
POLA1
Human Description:
polymerase (DNA directed), alpha 1, catalytic subunit [Source:HGNC Symbol;Acc:9173]
Mouse Orthologue:
Pola1
Mouse Description:
polymerase (DNA directed), alpha 1 Gene [Source:MGI Symbol;Acc:MGI:99660]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15650 Nonsense Available for shipment Available now
sa6767 Nonsense Mutation detected in F1 DNA During 2017
sa37893 Essential Splice Site Mutation detected in F1 DNA During 2017
sa45012 Nonsense Mutation detected in F1 DNA During 2017
sa44141 Nonsense Mutation detected in F1 DNA During 2017
sa39451 Nonsense Mutation detected in F1 DNA During 2017
sa24503 Nonsense Available for shipment Available now
sa44142 Nonsense Mutation detected in F1 DNA During 2017
sa18625 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15650
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066633 Nonsense 338 1390 9 35
ENSDART00000127188 Nonsense 351 1456 10 37
ENSDART00000128595 Nonsense 363 1468 10 37
ENSDART00000138097 Nonsense 337 738 9 36
Genomic Location (Zv9):
Chromosome 24 (position 24455932)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23702810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATGGAGATATGGTCTTCCGCTTCTACTGGTTGGATGCTTTTGAAGAT[C/T]AGTATAACCAACCTGGTGGGCATCTYTTTTYGTATGCTTTCTATCTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6767
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066633 Nonsense 374 1390 10 35
ENSDART00000127188 Nonsense 387 1456 11 37
ENSDART00000128595 Nonsense 399 1468 11 37
ENSDART00000138097 Nonsense 373 738 10 36
Genomic Location (Zv9):
Chromosome 24 (position 24457649)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23704527
KASP Assay ID:
554-5034.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACATGTTAGCTGTTGTGTTGCTGTAAAGAACATWGAGAGAACGATGTA[T/A]CTCCTTCCACGAGAACATGTGAGCCCATTCGTATTTAGTCAAAACTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37893
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066633 Essential Splice Site 757 1390 None 35
ENSDART00000127188 Essential Splice Site 773 1456 None 37
ENSDART00000128595 Essential Splice Site 785 1468 None 37
ENSDART00000138097 Essential Splice Site None 738 None 36
Genomic Location (Zv9):
Chromosome 24 (position 24463853)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23710731
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTACTCCCGCTAGCACTGCAGATCACTAACATCGCTGGTAATGTCATGG[T/C]AAGATACATTTATAAATGGTTATAACTACACCAATGCTAATCACATTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45012
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066633 Nonsense 819 1390 22 35
ENSDART00000127188 Nonsense 835 1456 23 37
ENSDART00000128595 Nonsense 847 1468 23 37
ENSDART00000138097   None 738 22 36
Genomic Location (Zv9):
Chromosome 24 (position 24465912)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGACTCTGGAAAGGGCAAGTCAAACAAAACTAGGAAGAAGGCAGCATA[T/A]GCTGGAGGTCTGGTGCTCGACCCAAAAGTCGGTAAGTCACTGTTTCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44141
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066633 Nonsense 903 1390 24 35
ENSDART00000127188 Nonsense 919 1456 25 37
ENSDART00000128595 Nonsense 931 1468 25 37
ENSDART00000138097   None 738 24 36
Genomic Location (Zv9):
Chromosome 24 (position 24467509)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23714387
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGGGCATTCTTCCCAAGGAAATCCGCAAACTGGTGGAGCGCAGACGA[C/T]AAGTCAAACAGCTAATGAAAGAGCCAGACCTCAACCCGGATCTGTACTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39451
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066633 Nonsense 919 1390 24 35
ENSDART00000127188 Nonsense 935 1456 25 37
ENSDART00000128595 Nonsense 947 1468 25 37
ENSDART00000138097   None 738 24 36
Genomic Location (Zv9):
Chromosome 24 (position 24467558)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23714436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGTCAAACAGCTAATGAAAGAGCCAGACCTCAACCCGGATCTGTACT[T/A]GCAGGTAAGTGCAATACCAGGCAGGATGTAAAAGGTGTGTTTGGCAATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24503
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066633 Nonsense 1034 1390 28 35
ENSDART00000127188 Nonsense 1050 1456 29 37
ENSDART00000128595 Nonsense 1062 1468 29 37
ENSDART00000138097   None 738 28 36
Genomic Location (Zv9):
Chromosome 24 (position 24490435)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23737313
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACATAGATGGTGTATTTAAGTCCCTTCTGCTGCTAAAAAAGAAGAAATA[T/A]GCAGCACTGATGGTTGAGCCACAGGGAGATGGCAAATACACCACCAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44142
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066633 Nonsense 1042 1390 28 35
ENSDART00000127188 Nonsense 1058 1456 29 37
ENSDART00000128595 Nonsense 1070 1468 29 37
ENSDART00000138097   None 738 28 36
Genomic Location (Zv9):
Chromosome 24 (position 24490457)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23737335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTTCTGCTGCTAAAAAAGAAGAAATATGCAGCACTGATGGTTGAGCCA[C/T]AGGGAGATGGCAAATACACCACCAAGCAGGAGCTCAAAGGCCTGGACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18625
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066633 Splice Site, Nonsense 1362 1390 35 35
ENSDART00000127188 Splice Site, Nonsense 1378 1456 36 37
ENSDART00000128595 Splice Site, Nonsense 1390 1468 36 37
ENSDART00000138097 Splice Site None 738 35 36
Genomic Location (Zv9):
Chromosome 24 (position 24526634)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23773512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GWTTTACCCAGTTTAATCTGTTATTTGTCTTTTTGTTTCTTCTTTCAGTA[T/G]TCTGAGAAGGCCCTCTACAACCAACTGAGMTTCTACAGATACATCTTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link