NP_001161735.1

Ensembl ID:
ENSDARG00000045305
Description:
high affinity cAMP-specific 3',5'-cyclic phosphodiesterase 7A [Source:RefSeq peptide;Acc:NP_0011617
Human Orthologue:
PDE7A
Human Description:
phosphodiesterase 7A [Source:HGNC Symbol;Acc:8791]
Mouse Orthologue:
Pde7a
Mouse Description:
phosphodiesterase 7A Gene [Source:MGI Symbol;Acc:MGI:1202402]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18558 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18558
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066630 Nonsense 156 490 5 13
ENSDART00000124317 Nonsense 171 505 6 14
ENSDART00000138741 Nonsense 156 490 5 13
ENSDART00000144791   None 170 None 6
ENSDART00000146570 Nonsense 126 144 4 4
Genomic Location (Zv9):
Chromosome 24 (position 25351293)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 24598171
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTNTTTTNTTGTCRATTTTTCTCAGTGTATGCTTGAAAAGGTTGGAAGCT[G/A]GAATTTTGACATTTTCCTCTTTGACCGACTTACAAATGGTAAATATTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link