gpr137c

Ensembl ID:
ENSDARG00000045289
ZFIN ID:
ZDB-GENE-041114-145
Description:
integral membrane protein GPR137C [Source:RefSeq peptide;Acc:NP_001007434]
Human Orthologue:
GPR137C
Human Description:
G protein-coupled receptor 137C [Source:HGNC Symbol;Acc:25445]
Mouse Orthologue:
Gpr137c
Mouse Description:
G protein-coupled receptor 137C Gene [Source:MGI Symbol;Acc:MGI:1917963]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23023 Nonsense Mutation detected in F1 DNA During 2016
sa36358 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15519 Essential Splice Site Available for shipment Available now
sa42893 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066604 Nonsense 79 433 1 7
Genomic Location:
Chromosome 17 (position 14807326)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACGGACACAAACGCTTCAGCTACCAGAGTGTTTTTCTCTTTCTGTGTT[T/A]GCTCTGGTCTGCTCTGAGGACGACGCTCTTCTCTTTTTACTTTAAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36358
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066604 Essential Splice Site 131 433 1 7
Genomic Location:
Chromosome 17 (position 14807484)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCCTGCAGTTCTTCACCCTGTGTCTGCTCAACCTTTATTTTGCTCAG[G/T]TAAGTGCTGTTTTCCCAATGTGTTTGTGTCTCGCAGTGTGTTGCACAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15519
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066604 Essential Splice Site 358 433 6 7
Genomic Location:
Chromosome 17 (position 14852595)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGATGACGACCTGACTAGAAACGCATCKTCCAGAGGAGAGAGATGCAG[G/A]TGTGTTCTCTATTTTTTGTCTTTTCAGTGATGYGAGTGCTATTGTTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42893
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066604 Nonsense 372 433 7 7
Genomic Location:
Chromosome 17 (position 14852989)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCCAGCAGTATCCTGTCATCCACACCACAAACGGGCCAAAGTTGGTA[C/A]GGCTCCATCCAGAGAAACAGCAGCCTCTCAGCCATCCCATACCTGAGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link