gpr137c

Ensembl ID:
ENSDARG00000045289
ZFIN ID:
ZDB-GENE-041114-145
Description:
integral membrane protein GPR137C [Source:RefSeq peptide;Acc:NP_001007434]
Human Orthologue:
GPR137C
Human Description:
G protein-coupled receptor 137C [Source:HGNC Symbol;Acc:25445]
Mouse Orthologue:
Gpr137c
Mouse Description:
G protein-coupled receptor 137C Gene [Source:MGI Symbol;Acc:MGI:1917963]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23023 Nonsense Mutation detected in F1 DNA During 2014
sa15519 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066604 Nonsense 79 433 1 7
Genomic Location:
Chromosome 17 (position 14807326)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACGGACACAAACGCTTCAGCTACCAGAGTGTTTTTCTCTTTCTGTGTT[T/A]GCTCTGGTCTGCTCTGAGGACGACGCTCTTCTCTTTTTACTTTAAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15519
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066604 Essential Splice Site 358 433 6 7
Genomic Location:
Chromosome 17 (position 14852595)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGATGACGACCTGACTAGAAACGCATCKTCCAGAGGAGAGAGATGCAG[G/A]TGTGTTCTCTATTTTTTGTCTTTTCAGTGATGYGAGTGCTATTGTTTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3rvcat9q