PTS

Ensembl ID:
ENSDARG00000045269
Description:
6-pyruvoyltetrahydropterin synthase [Source:HGNC Symbol;Acc:9689]
Human Orthologue:
PTS
Human Description:
6-pyruvoyltetrahydropterin synthase [Source:HGNC Symbol;Acc:9689]
Mouse Orthologue:
Pts
Mouse Description:
6-pyruvoyl-tetrahydropterin synthase Gene [Source:MGI Symbol;Acc:MGI:1338783]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8451 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8451
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066579 Essential Splice Site 55 143 3 9
Genomic Location (Zv9):
Chromosome 12 (position 325428)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCAGTGTCTCTCTTATGTCGTGMAAGAGCTCAAGTAAATCTCTTCATA[T/A]GCTTCATTTCTGTTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link