tectb

Ensembl ID:
ENSDARG00000045268
ZFIN ID:
ZDB-GENE-041212-16
Description:
beta-tectorin [Source:RefSeq peptide;Acc:NP_001008594]
Human Orthologue:
TECTB
Human Description:
tectorin beta [Source:HGNC Symbol;Acc:11721]
Mouse Orthologue:
Tectb
Mouse Description:
tectorin beta Gene [Source:MGI Symbol;Acc:MGI:109574]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22136 Nonsense Mutation detected in F1 DNA During 2014
sa24916 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22136
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066578 Nonsense 215 336 7 11
Genomic Location:
Chromosome 12 (position 33166572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTGTAATCACAAACTGCTGGGCAACACCAACTCCATATTCAACAGAC[A/T]GAAAAAGGTGGACTTTAATTCAGAACAGGTGAGGTTTTATTGTCAGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066578 Essential Splice Site 304 336 9 11
Genomic Location:
Chromosome 12 (position 33166119)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAACCTGATCCGAATGGAGGCATACTTACAATGGAGTTTCAAGTCAGAG[G/A]TATTTAACATTGGTACTTGTGCAAGATTTTTCAGTAACATATTCAGCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ab4ic8ei