gsnb

Ensembl ID:
ENSDARG00000045262
ZFIN ID:
ZDB-GENE-030131-8567
Description:
gelsolin b [Source:RefSeq peptide;Acc:NP_001082813]
Human Orthologue:
GSN
Human Description:
gelsolin [Source:HGNC Symbol;Acc:4620]
Mouse Orthologue:
Gsn
Mouse Description:
gelsolin Gene [Source:MGI Symbol;Acc:MGI:95851]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33746 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33746
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047110 Nonsense 678 728 16 16

The following transcripts of ENSDARG00000045262 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 66495050)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 62601833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTTACCATGCATCTCTTTACATTTCTCAATTTAGCGGCCAAATACATC[G/T]AATCAGATCCTGCCGGTAGGGATAAGAGAACCCCTATTGTTACAGTGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link