decr2

Ensembl ID:
ENSDARG00000045257
ZFIN ID:
ZDB-GENE-040426-2612
Description:
Peroxisomal 2,4-dienoyl-CoA reductase [Source:UniProtKB/Swiss-Prot;Acc:Q6NV34]
Human Orthologue:
DECR2
Human Description:
2,4-dienoyl CoA reductase 2, peroxisomal [Source:HGNC Symbol;Acc:2754]
Mouse Orthologue:
Decr2
Mouse Description:
2-4-dienoyl-Coenzyme A reductase 2, peroxisomal Gene [Source:MGI Symbol;Acc:MGI:1347059]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6779 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6779
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066558 Nonsense 126 300 6 10

The following transcripts of ENSDARG00000045257 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 39216460)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37825549
KASP Assay ID:
554-5115.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATATCATANNTATATTTTTTTAAATTTCTCAGATGCTGCAGGTAATTTCT[T/A]GTGTCCGGCTACATCTTTATCATTTAACGCTTTCAAGACTGTAATGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link