LOC567594

Ensembl ID:
ENSDARG00000045254
Human Orthologue:
C7orf50
Human Description:
chromosome 7 open reading frame 50 [Source:HGNC Symbol;Acc:22421]
Mouse Orthologue:
3110082I17Rik
Mouse Description:
RIKEN cDNA 3110082I17 gene Gene [Source:MGI Symbol;Acc:MGI:1920462]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44182 Nonsense Mutation detected in F1 DNA During 2016
sa12572 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44182
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066556 Nonsense 61 258 2 6
Genomic Location (Zv9):
Chromosome 24 (position 39205820)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37814909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTCACTGAAGAAAAAACGGAGAAAAAGCAGAAGAAGAGAAAGAAAAGC[A/T]AAACCGAGGCGAGTATATAGATAAAAGCATTAGTCTTCTTTTCATGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12572
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066556 Nonsense 253 258 6 6
Genomic Location (Zv9):
Chromosome 24 (position 39211339)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37820428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAAAAGAGGAMACAMAAGATGCTGAAAAGAAGCAACAGAGAGCCAAA[C/T]AAATCGTCCAGCTGCTATGAAACMCTCAACAATACATCACAATATGGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link