cebp1

Ensembl ID:
ENSDARG00000045240
ZFIN ID:
ZDB-GENE-010611-1
Description:
CCAAT/enhancer binding protein (C/EBP) 1 [Source:RefSeq peptide;Acc:NP_571912]
Human Orthologue:
CEBPE
Human Description:
CCAAT/enhancer binding protein (C/EBP), epsilon [Source:HGNC Symbol;Acc:1836]
Mouse Orthologue:
Cebpe
Mouse Description:
CCAAT/enhancer binding protein (C/EBP), epsilon Gene [Source:MGI Symbol;Acc:MGI:103572]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24574 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24574
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066522 Nonsense 159 169 2 2
ENSDART00000148282 Nonsense 159 169 3 4
Genomic Location:
Chromosome 24 (position 42404712)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCCAGCGCCTGCTGCACGAGGTGGAGGCGCTCAGGCATTACCTGTCC[C/T]AGCGTCACCTGCAGGACACATCTGAGGAGCACTGATGAGAATACACCTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jvqrdv2e