GLIPR1 (1 of 2)

Ensembl ID:
ENSDARG00000045224
Description:
GLI pathogenesis-related 1 [Source:HGNC Symbol;Acc:17001]
Human Orthologue:
GLIPR1
Human Description:
GLI pathogenesis-related 1 [Source:HGNC Symbol;Acc:17001]
Mouse Orthologue:
Glipr1
Mouse Description:
GLI pathogenesis-related 1 (glioma) Gene [Source:MGI Symbol;Acc:MGI:1920940]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17196 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17196
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066491 Nonsense 82 280 3 7
Genomic Location:
Chromosome 4 (position 2114738)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGCAGACGTGGGACGCAGCGCTGGCAGTGACGGCGCGGGCCTGGGCT[A/T]GATTCTGCCTCTTCAAACACAACATTYAYCTGCGGGAGGCAAAKCGGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/l49usnxb