dkk1b

Ensembl ID:
ENSDARG00000045219
ZFIN ID:
ZDB-GENE-990708-5
Description:
dickkopf-related protein 1 [Source:RefSeq peptide;Acc:NP_571078]
Human Orthologue:
DKK1
Human Description:
dickkopf homolog 1 (Xenopus laevis) [Source:HGNC Symbol;Acc:2891]
Mouse Orthologue:
Dkk1
Mouse Description:
dickkopf homolog 1 (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:1329040]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27882 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2017
sa27883 Nonsense Mutation detected in F1 DNA During 2017
sa16096 Nonsense Available for shipment Available now
sa9337 Nonsense Mutation detected in F1 DNA During 2017
sa19025 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27882
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066477 Essential Splice Site 65 241 2 4
ENSDART00000122271 Splice Site None 240 None 4
Genomic Location (Zv9):
Chromosome 12 (position 7149648)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6432379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTCAGACAGCTGGTGGTTTTTAGACTAATAGTGTATTTCCAAACCTCC[A/G]GCAGCCTTTAATCTGTGAGAGTGATGAGGAATGCGGTGGAGAGGAGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27883
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066477 Nonsense 145 241 3 4
ENSDART00000122271 Nonsense 144 240 3 4
Genomic Location (Zv9):
Chromosome 12 (position 7149997)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6432728
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAAGAGTTCGTGTCCATCGCCCATGAAAACTCTACTGCTCTAATGCCG[A/T]AAGTTTCGACTCAAGGATCACCACAAAACCAGATGCTGAAAGGTATGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16096
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066477 Nonsense 202 241 4 4
ENSDART00000122271 Nonsense 201 240 4 4
Genomic Location (Zv9):
Chromosome 12 (position 7150953)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6433684
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCAAGCCTGTCCTAAAAGAGGGCCAGGTCTGCACCAAGCACAAGAGG[A/T]AAGGCACTCATGGCTTGGAGATATTCCAGCGCTGCGACTGCGGGGAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066477 Nonsense 222 241 4 4
ENSDART00000122271 Nonsense 221 240 4 4
ENSDART00000066477 Nonsense 222 241 4 4
ENSDART00000122271 Nonsense 221 240 4 4
Genomic Location (Zv9):
Chromosome 12 (position 7151013)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6433744
KASP Assay ID:
2260-4949.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGCTTGGAGATATTCCAGCGCTGCGACTGCGGGGAAGGCCTGTCCTGC[A/T]GAACGCAGCGAGGAGACGGCGGCAAGGCTTCACGGAGTCTGCACACRTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066477 Nonsense 222 241 4 4
ENSDART00000122271 Nonsense 221 240 4 4
ENSDART00000066477 Nonsense 222 241 4 4
ENSDART00000122271 Nonsense 221 240 4 4
Genomic Location (Zv9):
Chromosome 12 (position 7151013)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6433744
KASP Assay ID:
2260-4949.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCTTGGAGATATTCCAGCGCTGCGACTGCGGGGAAGGCCTGTCCTGC[A/T]GAACGCAGCGAGGAGACGGCGGCAAGGCTTCACGGAGTCTGCACACATGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link