CACNA2D3 (2 of 2)

Ensembl ID:
ENSDARG00000045204
Description:
calcium channel, voltage-dependent, alpha 2/delta subunit 3 [Source:HGNC Symbol;Acc:15460]
Human Orthologue:
CACNA2D3
Human Description:
calcium channel, voltage-dependent, alpha 2/delta subunit 3 [Source:HGNC Symbol;Acc:15460]
Mouse Orthologue:
Cacna2d3
Mouse Description:
calcium channel, voltage-dependent, alpha2/delta subunit 3 Gene [Source:MGI Symbol;Acc:MGI:1338890]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10825 Essential Splice Site Available for shipment Available now
sa21406 Essential Splice Site Available for shipment Available now
sa5515 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10825
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066454 Essential Splice Site 118 1022 4 38
Genomic Location:
Chromosome 8 (position 55998029)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAAGTCTRTAGTGATTTTGTCATGTACTCTATTAATTAACTTGTGTTTC[A/T]GACTCAGACATCGTGAACGGGGTTTACTGGTCAGAGGCTCTCAAMACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21406
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066454 Essential Splice Site 183 1022 5 38
Genomic Location:
Chromosome 8 (position 55995625)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCTGATGAACACGGAGTTCTAGAGTTTGACTGTCGAAATCGGAAATGG[T/C]AAGACATTTTGTTTGCTTCTCAATCCTCTTCGCATCCAGCTGAGGAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5515
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066454 Essential Splice Site 549 1022 18 38
Genomic Location:
Chromosome 8 (position 55973117)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTCACAATGATTACTACTACACAGACATTAAAGGAACGCCCTTCAGG[T/C]GATATATGTTGGTTTCTGTTTCTTTACATTYAAAGTATAGTGTAAAACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/l0hmqm69