acta2

Ensembl ID:
ENSDARG00000045180
ZFIN ID:
ZDB-GENE-030131-1229
Description:
actin, aortic smooth muscle [Source:RefSeq peptide;Acc:NP_997785]
Human Orthologue:
ACTG2
Human Description:
actin, gamma 2, smooth muscle, enteric [Source:HGNC Symbol;Acc:145]
Mouse Orthologue:
Actg2
Mouse Description:
actin, gamma 2, smooth muscle, enteric Gene [Source:MGI Symbol;Acc:MGI:104589]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16546 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16546
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066430 Essential Splice Site 123 377 4 9
Genomic Location:
Chromosome 12 (position 18174374)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAGAAGCCCCACTTAATCCTAAAGCCAACAGGGAGAAGATGACCCAGG[T/C]TAGAGGTGTCACTGAGAAACCYAATRATGGGTACACATTTANTTTTTATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o1wm9zjt