pofut2

Ensembl ID:
ENSDARG00000045175
ZFIN ID:
ZDB-GENE-030131-3595
Description:
GDP-fucose protein O-fucosyltransferase 2 [Source:RefSeq peptide;Acc:NP_001071098]
Human Orthologue:
POFUT2
Human Description:
protein O-fucosyltransferase 2 [Source:HGNC Symbol;Acc:14683]
Mouse Orthologue:
Pofut2
Mouse Description:
protein O-fucosyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:1916863]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38755 Nonsense Mutation detected in F1 DNA During 2017
sa16726 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38755
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066424 Nonsense 138 444 2 9
Genomic Location (Zv9):
Chromosome 9 (position 41944506)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41069676
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTCTTCAGCATAACCAGCCTGCAGGCTAACATACCAGTCATTGAATAC[G/T]AGGAGTTTATTGCTGGTAAGTTACACTAGTTTCATTGATTGTTTCTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16726
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066424 Essential Splice Site 228 444 4 9
Genomic Location (Zv9):
Chromosome 9 (position 41939427)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41064597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGWCATGCRTCTATCCTGGCCCCTGTCTTACAAAATAACATAACAGCCAC[G/A]TAAGTCAATTTAGAAGRACTTGTGTGCACTYGGTACTRTGGGTGTACTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link