minpp1b

Ensembl ID:
ENSDARG00000045172
ZFIN ID:
ZDB-GENE-040426-888
Description:
multiple inositol polyphosphate histidine phosphatase 1 [Source:RefSeq peptide;Acc:NP_957394]
Human Orthologue:
MINPP1
Human Description:
multiple inositol-polyphosphate phosphatase 1 [Source:HGNC Symbol;Acc:7102]
Mouse Orthologue:
Minpp1
Mouse Description:
multiple inositol polyphosphate histidine phosphatase 1 Gene [Source:MGI Symbol;Acc:MGI:1336159]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38881 Nonsense Mutation detected in F1 DNA During 2017
sa31871 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38881
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012421 Nonsense 292 457 4 5
ENSDART00000130735 Nonsense 101 266 4 5
ENSDART00000138766   None 215 None 4
Genomic Location (Zv9):
Chromosome 12 (position 18553605)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17364182
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTTCAGTAACATGTTTTTGGTCTATTGATGTTGTAGGTGCTGGAGTA[T/A]AAAAATGACCTAAAACAGTATTGGAAGCGGGGATATGGACATGACATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31871
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012421 Nonsense 445 457 5 5
ENSDART00000130735 Nonsense 254 266 5 5
ENSDART00000138766   None 215 None 4
Genomic Location (Zv9):
Chromosome 12 (position 18550496)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17361073
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAAAGCATTACTCAAAGCTTCTTCATGGGTGCGATTTTAATAAGGAGTG[T/A]GATTTGCCTCAGTTGAATCTCAGGAACACTGAACTGTGAGTCAAATGATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Longevity: A meta-analysis of four genome-wide association studies of survival to age 90 years or older: the Cohorts for Heart and Aging Research in Genomic Epidemiology Consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link