NP_001165055.1

Ensembl ID:
ENSDARG00000045164
Description:
neuronal pentraxin 2b [Source:RefSeq peptide;Acc:NP_001165055]
Human Orthologue:
NPTX2
Human Description:
neuronal pentraxin II [Source:HGNC Symbol;Acc:7953]
Mouse Orthologue:
Nptx2
Mouse Description:
neuronal pentraxin 2 Gene [Source:MGI Symbol;Acc:MGI:1858209]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13823 Nonsense Available for shipment Available now
sa42006 Nonsense Mutation detected in F1 DNA During 2017
sa27934 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13823
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066407 Nonsense 16 426 1 5
Genomic Location (Zv9):
Chromosome 12 (position 18924354)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATGCTTCATCTGATCGCCGGACTCATTTGCGTCTATGGACTTACGTG[T/A]GTMAAAGTTGTTTACGGACAAACCGAGAAAGGGGAGCGTTTTCTGYGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42006
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066407 Nonsense 91 426 1 5
Genomic Location (Zv9):
Chromosome 12 (position 18924131)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17774990
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATTGTCAACCAGCTGGGAACAATTAAAGAACTGACTTCTAAACTTTCA[C/T]GATGTGAGTCTGAATCGGAAATATTCCGGAAAATGAATAAGGACACAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27934
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066407 Nonsense 137 426 2 5
Genomic Location (Zv9):
Chromosome 12 (position 18921773)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17772667
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATATCCACAATCATCCTTGTAATTTATTTTTTGTTTAACTTTTAAAG[C/T]AACAGCAAATGCGAGCCAATGCCTCTGGTGCCTCCTTCCCTAATGAGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link