sepx1b

Ensembl ID:
ENSDARG00000045160
ZFIN ID:
ZDB-GENE-040912-88
Description:
selenoprotein X, 1b [Source:RefSeq peptide;Acc:NP_001098598]
Human Orthologues:
AC011445.1, SEPX1
Human Descriptions:
selenoprotein X, 1 [Source:HGNC Symbol;Acc:14133]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9J506]
Mouse Orthologue:
Sepx1
Mouse Description:
selenoprotein X 1 Gene [Source:MGI Symbol;Acc:MGI:1351642]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35257 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35257
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066402 Nonsense 21 92 2 4
ENSDART00000146260 Nonsense 21 110 2 4
Genomic Location (Zv9):
Chromosome 12 (position 19555673)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18407834
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATGTATGTGTGTAACATTTAAAGCATGATGTTCCTCTGCAGGTATATA[T/A]GCTTGTTCCCAATGTGGACATCCGCTGTTTTCAAGTAGATCCAAGTATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link