si:ch211-147h1.4

Ensembl ID:
ENSDARG00000045157
ZFIN ID:
ZDB-GENE-040724-228
Description:
Novel protein similar to zebrafish pim-1 oncogene (Pim1) [Source:UniProtKB/TrEMBL;Acc:Q6ZM85]
Human Orthologue:
STK36
Human Description:
serine/threonine kinase 36 [Source:HGNC Symbol;Acc:17209]
Mouse Orthologue:
Stk36
Mouse Description:
serine/threonine kinase 36 (fused homolog, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920831]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2647 Nonsense F2 line generated During 2017
sa16385 Nonsense Available for shipment Available now
sa16035 Nonsense Available for shipment Available now
sa13039 Essential Splice Site Available for shipment Available now
sa9231 Essential Splice Site Mutation detected in F1 DNA During 2017
sa22074 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2647
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057918 Nonsense 62 258 2 5
Genomic Location (Zv9):
Chromosome 12 (position 19689853)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18542014
KASP Assay ID:
554-3041.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGATGCTTAAGTTGATGAATGCTCCACAATGTCCAAACATCATCGAAT[T/G]ATACGACTGGGTTGAGAATGAAAAGAACTTCATTCTCAGTCTGGAGTACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16385
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057918 Nonsense 106 258 2 5
ENSDART00000057918 Nonsense 106 258 2 5
Genomic Location (Zv9):
Chromosome 12 (position 19689984)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18542145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACAGATATATTTGAGATTGAAGAAAACCGAGCACGCCGGTTAATGCAT[C/T]AGTTCATCCAAGCTGTAATGTTCTGCKCTGAGCGTGGAGTTTTCCATGGS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16035
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057918 Nonsense 106 258 2 5
ENSDART00000057918 Nonsense 106 258 2 5
Genomic Location (Zv9):
Chromosome 12 (position 19689984)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18542145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACAGATATATTTGAGATTGAAGAAAACCGAGCACGCCGGTTAATGCAT[C/T]AGTTCATCCAAGCTGTAATGTTCTGCKCTGAGCGTGGAGTTTTCCATGGS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13039
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057918 Essential Splice Site 160 258 2 5
ENSDART00000057918 Essential Splice Site 160 258 2 5
Genomic Location (Zv9):
Chromosome 12 (position 19690150)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18542311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGCTCAGCCAATTACCCACAAGCCTTTCAATAGCAATCAATATCGAG[G/A]TGAGTTGGCRTTTTGTGTTAGTTTCTTTGGTCRCAGTATTGTCTWATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9231
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057918 Essential Splice Site 160 258 2 5
ENSDART00000057918 Essential Splice Site 160 258 2 5
Genomic Location (Zv9):
Chromosome 12 (position 19690150)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18542311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGCTCAGCCAATTACCCACAAGCCTTTCAATAGCAATCAATATCGAG[G/A]TGAGTTGGCRTTTTGTGTTAGTTTCTTTGGTCRCAGTATTGTCTWATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22074
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057918 Essential Splice Site None 258 4 5
Genomic Location (Zv9):
Chromosome 12 (position 19690770)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18542931
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGGAGCTGTAAGGCAAGAGGAGGTAGAGGAACACACCGAGCACAAAA[G/A]TACATCTTCATTTCTTTCTTTGCTTCATGCTATTCCTGTTGTTTTCTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link