NP_001017718.1

Ensembl ID:
ENSDARG00000045147
Description:
transmembrane protein 184B [Source:RefSeq peptide;Acc:NP_001017718]
Human Orthologue:
TMEM184B
Human Description:
transmembrane protein 184B [Source:HGNC Symbol;Acc:1310]
Mouse Orthologue:
Tmem184b
Mouse Description:
transmembrane protein 184b Gene [Source:MGI Symbol;Acc:MGI:2445179]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14778 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14778
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066389 Nonsense 80 387 3 9
ENSDART00000100075 Nonsense 109 416 3 9
Genomic Location (Zv9):
Chromosome 12 (position 20422422)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19204266
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATATAGTGCGAATCCTTTTCATCGTACCAATCTATGCCTTTGACTCTT[G/A]GCTCAGCCTTCTCTTCTKTACCAAYGACCAGTACTATGTGTACTTCGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link