LOC561790

Ensembl ID:
ENSDARG00000045142
Human Orthologues:
HBA1, HBA2, HBQ1, HBZ
Human Descriptions:
hemoglobin, alpha 1 [Source:HGNC Symbol;Acc:4823]
hemoglobin, alpha 2 [Source:HGNC Symbol;Acc:4824]
hemoglobin, theta 1 [Source:HGNC Symbol;Acc:4833]
hemoglobin, zeta [Source:HGNC Symbol;Acc:4835]
Mouse Orthologues:
F830116E18Rik, Hba-a1, Hba-a2, Hba-x, Hbq1
Mouse Descriptions:
hemoglobin alpha, adult chain 1 Gene [Source:MGI Symbol;Acc:MGI:96015]
hemoglobin alpha, adult chain 2 Gene [Source:MGI Symbol;Acc:MGI:96016]
hemoglobin X, alpha-like embryonic chain in Hba complex Gene [Source:MGI Symbol;Acc:MGI:96019]
hemoglobin, theta 1 Gene [Source:MGI Symbol;Acc:MGI:2685722]
RIKEN cDNA F830116E18 gene Gene [Source:MGI Symbol;Acc:MGI:3613460]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16420 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16420
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066383 Essential Splice Site 102 144 2 3
Genomic Location:
Chromosome 12 (position 21705736)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGAATTGCACRCCTTTCAGCTGAGAGTCGACCCTGCTAACTTCAAGG[T/C]ATACRCTACAAACCACTTGTTGTTTATTGCTAATTGAGTCCAACAGTTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v2b6er56