fkbp10

Ensembl ID:
ENSDARG00000045129
ZFIN ID:
ZDB-GENE-030131-3101
Description:
peptidyl-prolyl cis-trans isomerase FKBP10 [Source:RefSeq peptide;Acc:NP_001122138]
Human Orthologue:
FKBP10
Human Description:
FK506 binding protein 10, 65 kDa [Source:HGNC Symbol;Acc:18169]
Mouse Orthologue:
Fkbp10
Mouse Description:
FK506 binding protein 10 Gene [Source:MGI Symbol;Acc:MGI:104769]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13780 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13780
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066367 Nonsense 142 614 2 10

The following transcripts of ENSDARG00000045129 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 15016504)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCAAAGATGGCAAATTGCTGGTGTGGACAAGGGCATTCTGGGTATGTG[T/A]ATAAATGAACGCAGAAAGATCACGGTGCCTCCTCATCTGGCCCACGGTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2iricpma