OPLAH

Ensembl ID:
ENSDARG00000045123
Description:
5-oxoprolinase (ATP-hydrolysing) [Source:HGNC Symbol;Acc:8149]
Human Orthologue:
OPLAH
Human Description:
5-oxoprolinase (ATP-hydrolysing) [Source:HGNC Symbol;Acc:8149]
Mouse Orthologue:
Oplah
Mouse Description:
5-oxoprolinase (ATP-hydrolysing) Gene [Source:MGI Symbol;Acc:MGI:1922725]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15238 Essential Splice Site Available for shipment Available now
sa22054 Essential Splice Site Mutation detected in F1 DNA During 2014
sa1644 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa15238
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066359 Essential Splice Site 121 1291 2 26
Genomic Location:
Chromosome 12 (position 14763346)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RGACTTGCTACATATCGGAACCCAAGCACGGCCTAACCTTTTTGATTTGG[T/A]GAGTTTTGGTTGCTATGTAGATTTTTCCCAGTGACTTAATTGTTYTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22054
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066359 Essential Splice Site 266 1291 5 26
Genomic Location:
Chromosome 12 (position 14776877)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCTGTACCTGACTAAATTTACTGCAGGCTTTAAAGGAGGCTTGAAGG[T/C]ATGTCTGTGTGGTTTGTTTAATCAATCATATACAGTTGAAGTCAGAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1644
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066359 Nonsense 631 1291 13 26
Genomic Location:
Chromosome 12 (position 14790808)
KASP Assay ID:
554-1584.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGCTTATCTGACTTTTACTCTTTCTTTATCTACATCAGATATCTGAAA[G/T]AGTTTGGCTTCACTATCACTGATAGGCCTATCATGGTGGATGATATCCGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c74dykin