bmpr1ab

Ensembl ID:
ENSDARG00000045097
ZFIN ID:
ZDB-GENE-040912-150
Description:
bone morphogenetic protein receptor, type 1ab [Source:RefSeq peptide;Acc:NP_001004585]
Human Orthologue:
BMPR1A
Human Description:
bone morphogenetic protein receptor, type IA [Source:HGNC Symbol;Acc:1076]
Mouse Orthologue:
Bmpr1a
Mouse Description:
bone morphogenetic protein receptor, type 1A Gene [Source:MGI Symbol;Acc:MGI:1338938]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16062 Essential Splice Site Available for shipment Available now
sa22103 Nonsense Mutation detected in F1 DNA During 2014
sa28 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16062
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105621 Essential Splice Site 24 534 3 13
ENSDART00000125839 Essential Splice Site 25 535 3 13
Genomic Location:
Chromosome 12 (position 27555350)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCWTTGGCGTTTTAGTAGCTGCTGTCCTCCTCTCACCAYTGGCCGAGG[G/A]TAAGTCCAATTCATTACTATAAAGTGCCTACATTTGCCCATTGCKTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22103
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105621 Nonsense 27 534 4 13
ENSDART00000125839 Nonsense 28 535 4 13
Genomic Location:
Chromosome 12 (position 27532586)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGATATCTAAAAAAAATCTGATTTCCTCTATTTTAACCTTAGGTGGA[C/T]AAAACCCAGACTACATGCTTCATGGCACTGGAGTCAAGCCTGGATCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105621 Nonsense 108 534 5 13
ENSDART00000125839 Nonsense 109 535 5 13
Genomic Location:
Chromosome 12 (position 27532260)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAGGATGAGCACGGCGAGGCGATGCTGACCTCAGGCTGCATGAAGTA[C/A]GAGGGATCCCACTTCCAGTGCAAGGTAATTCATGAACGAGACAGTGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/omjoattb