cdkrap3

Ensembl ID:
ENSDARG00000045092
ZFIN ID:
ZDB-GENE-040625-90
Description:
CDK5 regulatory subunit-associated protein 3 [Source:RefSeq peptide;Acc:NP_001002105]
Human Orthologue:
CDK5RAP3
Human Description:
CDK5 regulatory subunit associated protein 3 [Source:HGNC Symbol;Acc:18673]
Mouse Orthologue:
Cdk5rap3
Mouse Description:
CDK5 regulatory subunit associated protein 3 Gene [Source:MGI Symbol;Acc:MGI:1933126]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7362 Missense Mutation detected in F1 DNA During 2014
sa22121 Nonsense Available for shipment Available now
sa3826 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7362
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066304 Missense 146 507 6 14
ENSDART00000133703 Missense 146 509 6 14
Genomic Location:
Chromosome 12 (position 30375681)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGGAAGCAGGTGTCTAAAGCTCAACAGCTGCAGCAGGAGCTGAGCCGA[C/T]GTGAGCTGGAGTGTCAGAGCGGTTCTGCCGACWTGAGAGAACGCTATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22121
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066304 Nonsense 180 507 7 14
ENSDART00000133703 Nonsense 180 509 7 14
Genomic Location:
Chromosome 12 (position 30375857)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACAAATAACATTTGTGTTTCACAGGGGGAAAACGTGGCAAGGGAGTTG[C/T]AAGCACAGGTTAAAGATCTGCCTGTGGTTTTAGAAGAAACTGGAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3826
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066304 Essential Splice Site 360 507 11 14
ENSDART00000133703 Essential Splice Site 362 509 11 14
Genomic Location:
Chromosome 12 (position 30378330)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGGAAAACTCACAAACACGTAGCCAGTTCATCAATGAACTAAAGGAGG[T/C]ACTGTTTTTTACTTRCATAAGTATTACACAGACTTTTTAATTSCTACMAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Epilepsy (generalized): Genome-wide association analysis of genetic generalized epilepsies implicates susceptibility loci at 1q43, 2p16.1, 2q22.3 and 17q21.32 (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q4p63wan