mrpl10

Ensembl ID:
ENSDARG00000045091
ZFIN ID:
ZDB-GENE-050320-19
Description:
39S ribosomal protein L10, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q5BJB7]
Human Orthologue:
MRPL10
Human Description:
mitochondrial ribosomal protein L10 [Source:HGNC Symbol;Acc:14055]
Mouse Orthologue:
Mrpl10
Mouse Description:
mitochondrial ribosomal protein L10 Gene [Source:MGI Symbol;Acc:MGI:1333801]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12492 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12492
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066303 Nonsense 150 252 4 5

The following transcripts of ENSDARG00000045091 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 30345245)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCATTTACGGTAACATGTCACCTCTAATTTTTGGCGAGACTGTCCTGT[T/A]AGCTAGTAAAGAGCCAAAAGTTAAAGAGATGCTGCAGGCATTGAGGCACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xdocwv0p