tmem106a

Ensembl ID:
ENSDARG00000045075
ZFIN ID:
ZDB-GENE-030131-5129
Description:
transmembrane protein 106A [Source:RefSeq peptide;Acc:NP_001122148]
Human Orthologue:
TMEM106A
Human Description:
transmembrane protein 106A [Source:HGNC Symbol;Acc:28288]
Mouse Orthologue:
Tmem106a
Mouse Description:
transmembrane protein 106A Gene [Source:MGI Symbol;Acc:MGI:1922056]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22112 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22112
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066270 Nonsense 15 231 2 8
ENSDART00000123739 Nonsense 15 231 2 8
ENSDART00000133023 Nonsense 34 250 2 8

The following transcripts of ENSDARG00000045075 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 28803273)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATTATGTCTCAAAATAAAAATGGAGAGAAAAGGAGGCTTTCCAAATG[G/A]TTGGACTATGGCAGTATCAATGGGGAAGGACAGTCGGATCCGTGTCCTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wnaib2ea