chad

Ensembl ID:
ENSDARG00000045071
ZFIN ID:
ZDB-GENE-040426-1130
Description:
chondroadherin [Source:RefSeq peptide;Acc:NP_957357]
Human Orthologue:
CHAD
Human Description:
chondroadherin [Source:HGNC Symbol;Acc:1909]
Mouse Orthologue:
Chad
Mouse Description:
chondroadherin Gene [Source:MGI Symbol;Acc:MGI:1096866]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17612 Nonsense Available for shipment Available now
sa11952 Nonsense Available for shipment Available now
sa19040 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17612
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066264 Nonsense 90 363 1 4
Genomic Location:
Chromosome 12 (position 28083940)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGGCTTCAGTGAGATGAAAGGGCTCATTTCTCTGCACCTGCAGCATTGC[C/T]AGATCCGAGAGCTCTCCGGCCAGGCTTTCWAAGGGCTCAACAAGCTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11952
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066264 Nonsense 100 363 1 4
ENSDART00000066264 Nonsense 100 363 1 4
Genomic Location:
Chromosome 12 (position 28083970)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGCACCTGCAGCATTGCCAGATCCGAGAGCTCTCCGGCCAGGCTTTC[A/T]AAGGGCTCAACAAGCTCATCTACCTCTACCTGTCTGATAATGAGATCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19040
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066264 Nonsense 100 363 1 4
ENSDART00000066264 Nonsense 100 363 1 4
Genomic Location:
Chromosome 12 (position 28083970)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGCACCTGCAGCATTGCCAGATCCGAGAGCTCTCCGGCCAGGCTTTC[A/T]AAGGGCTCAACAAGCTCATCTACCTCTACCTGTCTGATAATGAGATCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/24xig9ul