itgb3b

Ensembl ID:
ENSDARG00000045070
ZFIN ID:
ZDB-GENE-071207-2
Description:
integrin beta-3 [Source:RefSeq peptide;Acc:NP_001076417]
Human Orthologue:
ITGB3
Human Description:
integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) [Source:HGNC Symbol;Acc:6156]
Mouse Orthologue:
Itgb3
Mouse Description:
integrin beta 3 Gene [Source:MGI Symbol;Acc:MGI:96612]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7699 Nonsense Mutation detected in F1 DNA During 2014
sa17932 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7699
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006908 Nonsense 125 790 4 15
Genomic Location:
Chromosome 12 (position 28010743)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACATGTYCCTCCATGACTCAATTGTTACTCTGYCATCCCACAGATGATT[C/A]GCAGGTTTTCAAGCTGAAAGTCCGACAGGTAGAGGACTACCCTGTGGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17932
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006908 Essential Splice Site 422 790 9 15
Genomic Location:
Chromosome 12 (position 28016268)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTCATTCCTGGGCTGAGATCCTGCTCAGGCCTCAAAAGAGGAGATACC[G/T]TTAGTATCTTATTCCTTCTTTATCTCTATCWGTCAGTTTCTCTAATTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/inn5h2ga