entpd1

Ensembl ID:
ENSDARG00000045066
ZFIN ID:
ZDB-GENE-040801-58
Description:
ectonucleoside triphosphate diphosphohydrolase 1 [Source:RefSeq peptide;Acc:NP_001003545]
Human Orthologue:
ENTPD1
Human Description:
ectonucleoside triphosphate diphosphohydrolase 1 [Source:HGNC Symbol;Acc:3363]
Mouse Orthologue:
Entpd1
Mouse Description:
ectonucleoside triphosphate diphosphohydrolase 1 Gene [Source:MGI Symbol;Acc:MGI:102805]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17164 Essential Splice Site Available for shipment Available now
sa22131 Nonsense Mutation detected in F1 DNA During 2014
sa16712 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17164
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066257 Essential Splice Site 134 492 5 10
ENSDART00000126466 Essential Splice Site 138 496 5 10
Genomic Location:
Chromosome 12 (position 32415246)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTGAATTAACTGTCAAAAGGTAAATTCCAAWACTWTTTATTTTCTCA[A/T]GGATGGAGRATGAAATGGCCTCAGAAAAAGTGCTTACCTCCGTTGCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22131
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066257 Nonsense 280 492 7 10
ENSDART00000126466 Nonsense 284 496 7 10
Genomic Location:
Chromosome 12 (position 32408229)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTAAGGGATCCTTGTTTTCATCCTGGATATAACACCACCAAGACGCTT[G/T]AAAGTGTCAATACACCGTGTATGAAACCACTGAAAATGCCAAAGGAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16712
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066257 Nonsense 305 492 7 10
ENSDART00000126466 Nonsense 309 496 7 10
Genomic Location:
Chromosome 12 (position 32408152)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACTGAAAATGCCAAAGGAGCAGTTCTCCCAYGTGGGGCTTGGAAATTG[G/A]TCTCAGTGCCAAGAATYAATCAGAAAGGTTTTTAATACTAGCCATTGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tqcnia0v