ablim1b

Ensembl ID:
ENSDARG00000045064
ZFIN ID:
ZDB-GENE-050327-91
Description:
actin binding LIM protein 1b [Source:RefSeq peptide;Acc:NP_001014385]
Human Orthologue:
ABLIM1
Human Description:
actin binding LIM protein 1 [Source:HGNC Symbol;Acc:78]
Mouse Orthologue:
Ablim1
Mouse Description:
actin-binding LIM protein 1 Gene [Source:MGI Symbol;Acc:MGI:1194500]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18272 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18272
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042572 None None 354 None 10
ENSDART00000126354 Nonsense 464 786 15 26
ENSDART00000126396 None None 302 None 8
ENSDART00000132335 None None 110 None 5
ENSDART00000133367 None None 185 None 6
ENSDART00000138252 None None 272 None 11
ENSDART00000142756 None None 201 None 10

The following transcripts of ENSDARG00000045064 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 31776757)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCCTCTCCTCTGAGCGGCCGGCAGGAATGCTGAAGCTCTGCTCCTCTT[T/A]GCGCTCCAGCAACAGTGACACGCGCCCTACCTCCCCCTTTCGACATCACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rb5ne3qi