rab9a

Ensembl ID:
ENSDARG00000045027
ZFIN ID:
ZDB-GENE-060825-293
Description:
ras-related protein Rab-9A [Source:RefSeq peptide;Acc:NP_001038931]
Human Orthologue:
RAB9A
Human Description:
RAB9A, member RAS oncogene family [Source:HGNC Symbol;Acc:9792]
Mouse Orthologue:
Rab9
Mouse Description:
RAB9, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:1890695]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38767 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38767
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066198 Nonsense 178 201 5 5
Genomic Location (Zv9):
Chromosome 9 (position 56684711)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 55114838
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCGGTTGCGTTCGAGGAGGCGGTGAGAAGAGTGCTGTCTCTGGAGGAC[A/T]GACACGAGCATCTGATTCCTACAGACACTGTGAATCTGCACAGGAAACCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link