CYP27B1

Ensembl ID:
ENSDARG00000045015
Description:
cytochrome P450, family 27, subfamily B, polypeptide 1 [Source:HGNC Symbol;Acc:2606]
Human Orthologue:
CYP27B1
Human Description:
cytochrome P450, family 27, subfamily B, polypeptide 1 [Source:HGNC Symbol;Acc:2606]
Mouse Orthologue:
Cyp27b1
Mouse Description:
cytochrome P450, family 27, subfamily b, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1098274]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34997 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34997
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066178 Essential Splice Site 403 506 7 9
Genomic Location (Zv9):
Chromosome 11 (position 323232)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 309969
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTCATCAACAAAGACATCGAAGTCGGAGGATACGTCATTCCTAAAAAC[G/A]TGAGTGTTGAAACATTTGCTTGGTTTCTGTAGTGTTAAAGATGCTGTGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link