tuba2

Ensembl ID:
ENSDARG00000045014
ZFIN ID:
ZDB-GENE-040426-1970
Description:
tubulin alpha-1D chain [Source:RefSeq peptide;Acc:NP_998195]
Human Orthologue:
TUBA1C
Human Description:
tubulin, alpha 1c [Source:HGNC Symbol;Acc:20768]
Mouse Orthologue:
Tuba1c
Mouse Description:
tubulin, alpha 1C Gene [Source:MGI Symbol;Acc:MGI:1095409]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9405 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066177 Nonsense 378 451 4 4
Genomic Location:
Chromosome 11 (position 3319372)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTGTCCCGGGTGGAGATTTGGCRAGAGTTCAGCGTGCCGTCTGCATGT[T/A]GAGCAACACCACTGCTATTGCCGAAGCCTGGGCTAGGCTTGATCACAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/11byk8qo