si:ch211-51f10.1

Ensembl ID:
ENSDARG00000045011
ZFIN ID:
ZDB-GENE-060503-136
Description:
hypothetical protein LOC100034470 [Source:RefSeq peptide;Acc:NP_001124083]
Human Orthologue:
TAPBP
Human Description:
TAP binding protein (tapasin) [Source:HGNC Symbol;Acc:11566]
Mouse Orthologue:
Tapbp
Mouse Description:
TAP binding protein Gene [Source:MGI Symbol;Acc:MGI:1201689]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23435 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23435
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053438 Nonsense 141 244 4 6
ENSDART00000104848 Nonsense 221 465 4 8
Genomic Location (Zv9):
Chromosome 19 (position 7691543)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7150082
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGTTCGCTGTAGACTGGGAGAGCCGGTTCTGCTGGATTGTGGCTTCTG[G/A]ATTGATCCGTCTTCTCCTCTTCACGGCTCTGGATTCTCCATCGAGTGGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link