ptprga

Ensembl ID:
ENSDARG00000045006
ZFIN ID:
ZDB-GENE-101101-4
Description:
Protein-tyrosine phosphatase gamma-a [Source:UniProtKB/TrEMBL;Acc:C7U133]
Human Orthologue:
PTPRG
Human Description:
protein tyrosine phosphatase, receptor type, G [Source:HGNC Symbol;Acc:9671]
Mouse Orthologue:
Ptprg
Mouse Description:
protein tyrosine phosphatase, receptor type, G Gene [Source:MGI Symbol;Acc:MGI:97814]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21839 Nonsense Available for shipment Available now
sa27719 Nonsense Mutation detected in F1 DNA During 2017
sa21840 Nonsense Available for shipment Available now
sa14383 Nonsense Available for shipment Available now
sa27721 Essential Splice Site Mutation detected in F1 DNA During 2017
sa10080 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21839
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092552 Nonsense 104 1414 3 30
ENSDART00000122270   None 234 None 8
Genomic Location (Zv9):
Chromosome 11 (position 5343919)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5313375
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATAGCCGACCAAGACACTAAGGTCTCGATGGAGTACCAGGAGCTCACAT[T/A]GGACGGGTTTGATGCGGAGTCGTCCAACAAAACGTCAATGAAGAACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27719
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092552 Nonsense 132 1414 4 30
ENSDART00000122270   None 234 None 8
Genomic Location (Zv9):
Chromosome 11 (position 5350293)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5319749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCTCTTTCTTTTTTCCTCACAGTGGCGATCTTTCTGAAGGACGATTA[T/A]TTCGTGAGAGGAGCCGGGCTACCGGGCCGTTTCAAAGCCGAGAAGGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21840
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092552 Nonsense 323 1414 8 30
ENSDART00000122270   None 234 None 8
Genomic Location (Zv9):
Chromosome 11 (position 5446991)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5416447
KASP Assay ID:
2260-3871.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGGCCACTCCAGAGTCTGGACAACCGAGAGGTCTTCAAATCCGCTGTC[A/T]AAGACGCGTGGCTGCCTGATTTGACTTACCCCCCGGGGAACCCGTACGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14383
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092552 Nonsense 562 1414 12 30
ENSDART00000122270   None 234 None 8
Genomic Location (Zv9):
Chromosome 11 (position 5480273)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5449729
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCTCCACCCACCAGAGCCCRGCCAAACCTGTGGTGACCACTGCAGAA[C/T]AGGCCTCTGACRCAGACACCACCMCAGCCACTGAYAACGACAGGTCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27721
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092552 Essential Splice Site 1030 1414 21 30
ENSDART00000122270   None 234 None 8
Genomic Location (Zv9):
Chromosome 11 (position 5524646)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5494102
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCTGCCGCACAGACCCCAGACATGGGCCCCATGCTTGTACACTGCAG[G/A]TAAAACCCACACACATTTGAGTATTGTTTATAGTTTACATTTGTATTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10080
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092552 Essential Splice Site 1124 1414 23 30
ENSDART00000122270 Essential Splice Site 6 234 1 8
Genomic Location (Zv9):
Chromosome 11 (position 5528329)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5497785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGACGCCGGGCCCAGGGGGCAAAAMACGACTAGAGAAGCAGTTYAAG[G/A]TGGGCACCGTCTCTTTCTTTATGCAAAGTATATTCAACAAGCAATTTATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link