bcap31

Ensembl ID:
ENSDARG00000044972
ZFIN ID:
ZDB-GENE-030616-63
Description:
B-cell receptor-associated protein 31 [Source:RefSeq peptide;Acc:NP_956386]
Human Orthologue:
BCAP31
Human Description:
B-cell receptor-associated protein 31 [Source:HGNC Symbol;Acc:16695]
Mouse Orthologue:
Bcap31
Mouse Description:
B-cell receptor-associated protein 31 Gene [Source:MGI Symbol;Acc:MGI:1350933]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34306 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34306
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066107 Nonsense 149 247 5 8
ENSDART00000130743 Nonsense 149 247 4 7

The following transcripts of ENSDARG00000044972 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 9538076)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8954658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGCCTTCCAAAAGCAGGCGGAGGGAGCAAATGATGCCGCCAAGAAATA[C/A]ATGGAGGAAAATGAGAAACTGCAGGAGGTGAGAGAGTTGTGCATGACAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link