LOC798737

Ensembl ID:
ENSDARG00000044969
Human Orthologues:
GALR2, GALR3
Human Descriptions:
galanin receptor 2 [Source:HGNC Symbol;Acc:4133]
galanin receptor 3 [Source:HGNC Symbol;Acc:4134]
Mouse Orthologue:
Galr2
Mouse Description:
galanin receptor 2 Gene [Source:MGI Symbol;Acc:MGI:1337018]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20110 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20110
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066104 Nonsense 231 378 2 2
Genomic Location:
Chromosome 3 (position 43140487)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTACCTCTGGACAGCAGTCGACCCGCTTGATGGGATGTCGGAGTCGAAA[C/T]GAGCAAAGCGCAAGGTCACCAAGATGATCATTATAGTCACGGTGCTCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w7ngt9ds