pygo1

Ensembl ID:
ENSDARG00000044963
ZFIN ID:
ZDB-GENE-080204-62
Description:
pygopus homolog 1 [Source:RefSeq peptide;Acc:NP_001107109]
Human Orthologue:
PYGO1
Human Description:
pygopus homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:30256]
Mouse Orthologue:
Pygo1
Mouse Description:
pygopus 1 Gene [Source:MGI Symbol;Acc:MGI:1919385]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17313 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17313
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066097 Nonsense 84 337 3 3
Genomic Location (Zv9):
Chromosome 13 (position 52276430)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2873759
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGCCAATCCTTTCGATGACAATTACRTCTCTCCATCCCTGAAGCCKTA[T/A]TTTGGACACTCGCATTACCCAGCATCCAACAGCTATGGGTCGTCCAGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link