npepps

Ensembl ID:
ENSDARG00000044943
ZFIN ID:
ZDB-GENE-060524-3
Description:
puromycin-sensitive aminopeptidase [Source:RefSeq peptide;Acc:NP_001157499]
Human Orthologues:
NPEPPS, RP11-1407O15.2
Human Descriptions:
aminopeptidase puromycin sensitive [Source:HGNC Symbol;Acc:7900]
Puromycin-sensitive aminopeptidase-like protein [Source:UniProtKB/Swiss-Prot;Acc:A6NEC2]
Mouse Orthologue:
Npepps
Mouse Description:
aminopeptidase puromycin sensitive Gene [Source:MGI Symbol;Acc:MGI:1101358]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35043 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35043
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066065   None 173 None 6
ENSDART00000130318 Essential Splice Site 375 872 10 23
ENSDART00000147670 Essential Splice Site 428 925 10 23
Genomic Location (Zv9):
Chromosome 11 (position 12321113)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 12152664
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCAGGGCTCTGGACCTGGATGCGCTAGATAACAGCCACCCTATTGAGG[T/C]CCGCAAGAGATGAGTATATCTCCCCCAGTGTGTGTCTCTGCTGTTTGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link