hpd

Ensembl ID:
ENSDARG00000044935
ZFIN ID:
ZDB-GENE-040808-62
Description:
4-hydroxyphenylpyruvate dioxygenase [Source:RefSeq peptide;Acc:NP_001003742]
Human Orthologue:
HPD
Human Description:
4-hydroxyphenylpyruvate dioxygenase [Source:HGNC Symbol;Acc:5147]
Mouse Orthologue:
Hpd
Mouse Description:
4-hydroxyphenylpyruvic acid dioxygenase Gene [Source:MGI Symbol;Acc:MGI:96213]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25400 Essential Splice Site Mutation detected in F1 DNA During 2017
sa27241 Nonsense Mutation detected in F1 DNA During 2017
sa21339 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa25400
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066050 Essential Splice Site 199 393 9 14
Genomic Location (Zv9):
Chromosome 8 (position 35874853)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 34803277
KASP Assay ID:
554-7620.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGGTTGGAAATCAGCCTGACAGTGAGATGGTGCCAATAGTGGAGTGG[T/A]AAAAAAAACTTTTCTGAAAACACATTGTTGAACTTTCTTCAGATCTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27241
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066050 Nonsense 232 393 10 14
Genomic Location (Zv9):
Chromosome 8 (position 35876733)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 34805157
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTGCAGACTGAATACAGTGCGCTGCGCTCCATAGTGGTGGCCAACTA[T/G]GAAGAAACTGTCAAAATGCCAATCAATGAACCAGCCATGGGAAAGCGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21339
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066050 Essential Splice Site 277 393 11 14
Genomic Location (Zv9):
Chromosome 8 (position 35876956)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 34805380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCGGGGGTTCAACACATCGCTATGAACACCTCTGACATTATTTCAGCT[G/T]TGAGTAAACTACAGACAGATTTCACACTAATGGATTCATTGAGAAGACCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link