gdf11

Ensembl ID:
ENSDARG00000044924
ZFIN ID:
ZDB-GENE-040427-2
Description:
growth/differentiation factor 11 [Source:RefSeq peptide;Acc:NP_998140]
Human Orthologue:
GDF11
Human Description:
growth differentiation factor 11 [Source:HGNC Symbol;Acc:4216]
Mouse Orthologue:
Gdf11
Mouse Description:
growth differentiation factor 11 Gene [Source:MGI Symbol;Acc:MGI:1338027]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2613 Nonsense F2 line generated During 2014
sa17191 Nonsense Available for shipment Available now
sa10394 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2613
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066033 Nonsense 61 390 1 3
Genomic Location:
Chromosome 11 (position 15975821)
KASP Assay ID:
554-3302.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTGGATGATGTGGAGTCTTCTGAGTGTTCAGCGTGCGTGTGGAGAGAA[C/T]AGAGTAAAGTCTTGCGACTGGAAACAATTAAATCACAAATACTTAGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17191
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066033 Nonsense 80 390 1 3
ENSDART00000066033 Nonsense 80 390 1 3
Genomic Location:
Chromosome 11 (position 15975879)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCTTGCRACTGGAAACAATTAAATCACAAATACTTAGCAAACTGCGCT[T/G]AAAACAAGCACCCAACATCAGCAGAGAGGTGGTTAATCAGCTTCTTCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10394
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066033 Nonsense 80 390 1 3
ENSDART00000066033 Nonsense 80 390 1 3
Genomic Location:
Chromosome 11 (position 15975879)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCTTGCRACTGGAAACAATTAAATCACAAATACTTAGCAAACTGCGCT[T/G]AAAACAAGCACCCAACATCAGCAGAGAGGTGGTTAATCAGCTTCTTCCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/693v1efg