SFMBT1

Ensembl ID:
ENSDARG00000044915
Description:
Scm-like with four mbt domains 1 [Source:HGNC Symbol;Acc:20255]
Human Orthologue:
SFMBT1
Human Description:
Scm-like with four mbt domains 1 [Source:HGNC Symbol;Acc:20255]
Mouse Orthologue:
Sfmbt1
Mouse Description:
Scm-like with four mbt domains 1 Gene [Source:MGI Symbol;Acc:MGI:1859609]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35056 Nonsense Mutation detected in F1 DNA During 2017
sa8532 Nonsense Mutation detected in F1 DNA During 2017
sa44737 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35056
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041725 Nonsense 113 869 2 19
Genomic Location (Zv9):
Chromosome 11 (position 18736277)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18153591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGGTGCGACATCATGACCGCTGACCTGCACCCGATTGGATGGAGCAAA[C/T]AGCAAGGTCGAATGATGAAACCTCCAGAGGGTGAGCAGAGATTTGTGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8532
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041725 Nonsense 456 869 10 19
Genomic Location (Zv9):
Chromosome 11 (position 18710403)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18127807
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGACTCCATGGATATTTTCCCAGTGAGCTGGTGTGAGACAAATGGTTA[T/A]CCTCTACTGCACCCCTGCAAGCCCAGAGGTCRGTTTTAMAGCATAAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44737
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041725 Nonsense 569 869 14 19
Genomic Location (Zv9):
Chromosome 11 (position 18705961)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGCTACTGATAAACTCCGCTTATAAACCCAGTCGAGTGCTGAGAGAAT[T/A]GCAGCTGGACCAGGAGGGTCGCTGGCAGGGCCATGGAGAGACACTTAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)
  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link