atp2b4

Ensembl ID:
ENSDARG00000044902
ZFIN ID:
ZDB-GENE-061027-60
Description:
ATPase, Ca++ transporting, plasma membrane 4 [Source:RefSeq peptide;Acc:NP_001070935]
Human Orthologue:
ATP2B4
Human Description:
ATPase, Ca++ transporting, plasma membrane 4 [Source:HGNC Symbol;Acc:817]
Mouse Orthologue:
Atp2b4
Mouse Description:
ATPase, Ca++ transporting, plasma membrane 4 Gene [Source:MGI Symbol;Acc:MGI:88111]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10432 Essential Splice Site Available for shipment Available now
sa6208 Nonsense Mutation detected in F1 DNA During 2014
sa21897 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10432
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046122 Essential Splice Site 682 1174 12 21
ENSDART00000127791 Essential Splice Site 682 1174 11 21

The following transcripts of ENSDARG00000044902 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 23914231)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGACATGCATCTGTGTTGTYGGCATTGAAGACCCTGTCCGTCCTGAGG[T/C]GAGCAAAACCATCCAATTTGCTTGTTCCAAATAGTGACRTGCTTGTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046122 Nonsense 910 1174 17 21
ENSDART00000127791 Nonsense 910 1174 16 21

The following transcripts of ENSDARG00000044902 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 23900935)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTTGGCAACAGAACCCCCAAYAGAATCGCTCCTTCTGAGAAAACCGTA[C/A]GGTCGCGACAAGCCACTCATTTCTAGGACTATGATGAAGAATATATTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046122 Nonsense 1102 1174 20 21
ENSDART00000127791 Nonsense 1102 1174 19 21

The following transcripts of ENSDARG00000044902 do not overlap with this mutation:

Genomic Location:
Chromosome 11 (position 23885293)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATTGACCACGCTGAGATGGAGCTGCGCAGAGGACAGATCCTGTGGTTC[A/T]GAGGACTCAACCGTATCCAGACTCAGGCAAGCTCACCTTTTATGGTTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast size: Genetic variants associated with breast size also influence breast cancer risk. (View Study)
  • Malaria: Genome-wide association study indicates two novel resistance loci for severe malaria. (View Study)
  • Platelet counts: GWAS of blood cell traits identifies novel associated loci and epistatic interactions in Caucasian and African-American children. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dsns29ur