tmem183a

Ensembl ID:
ENSDARG00000044899
ZFIN ID:
ZDB-GENE-050327-5
Description:
transmembrane protein 183 [Source:RefSeq peptide;Acc:NP_001014317]
Human Orthologue:
TMEM183A
Human Description:
transmembrane protein 183A [Source:HGNC Symbol;Acc:20173]
Mouse Orthologue:
Tmem183a
Mouse Description:
transmembrane protein 183A Gene [Source:MGI Symbol;Acc:MGI:1914729]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21896 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21895 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065996 Essential Splice Site 247 364 6 8
ENSDART00000146873 Essential Splice Site 201 269 5 7
Genomic Location:
Chromosome 11 (position 23200127)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGTAGGTCAGAGCAGATGTGGGAATTCAACTTCAAGTTTGTGAAACTG[G/A]TATGCTCACTATACCTTCGTAAAAGCTAATAAGACATGATTCTGTGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21895
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065996 Nonsense 312 364 8 8
ENSDART00000146873 Nonsense 266 269 7 7
Genomic Location:
Chromosome 11 (position 23197803)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTTGTCTTTCAGTTCACCATTAATGTGAGCACAGACATGAGGCATCAC[C/T]GAGTTCGGTTGGAGTTCCAGGATTCACCAATGATTCGGGGAAAAAAGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5rsg6hyd