opn1lw2

Ensembl ID:
ENSDARG00000044861
ZFIN ID:
ZDB-GENE-040718-141
Description:
Red-sensitive opsin-2 [Source:UniProtKB/Swiss-Prot;Acc:Q8AYN0]
Human Orthologues:
OPN1LW, OPN1MW, OPN1MW2
Human Descriptions:
opsin 1 (cone pigments), long-wave-sensitive [Source:HGNC Symbol;Acc:9936]
opsin 1 (cone pigments), medium-wave-sensitive 2 [Source:HGNC Symbol;Acc:26952]
opsin 1 (cone pigments), medium-wave-sensitive [Source:HGNC Symbol;Acc:4206]
Mouse Orthologue:
Opn1mw
Mouse Description:
opsin 1 (cone pigments), medium-wave-sensitive (color blindness, deutan) Gene [Source:MGI Symbol;Acc

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31832 Essential Splice Site Available for shipment Available now
sa21914 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31832
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065940 Essential Splice Site 132 356 3 7

The following transcripts of ENSDARG00000044861 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 26415340)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25244165
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCGGACATCCCATGTGTATTTTTGAAGGCTACACTGTGTCAGTATGTG[G/A]TAAGTTACTACACACAGAAAGCAAACTGAATAGTGTGCTGGACTGAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21914
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065940 Nonsense 136 356 4 7

The following transcripts of ENSDARG00000044861 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 26415432)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25244257
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGAAGATTTAGGAGGTTTTTAATGATATTTACCAACACAGGTATTGCT[G/T]GACTGTGGTCGTTGACTGTCATCTCTTGGGAAAGATGGGTGGTTGTCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link